C12orf51 (1 of 3)

Ensembl ID:
ENSDARG00000079151
Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Human Orthologue:
C12orf51
Human Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Mouse Orthologue:
Gm15800
Mouse Description:
predicted gene 15800 Gene [Source:MGI Symbol;Acc:MGI:3647820]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14065 Essential Splice Site Available for shipment Available now
sa7110 Nonsense Mutation detected in F1 DNA During 2014
sa21151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Essential Splice Site 450 1044 10 20
Genomic Location:
Chromosome 7 (position 74651776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTRAAGCACWTTTTTTGGTTTATATGCAGTTGGTTTGTTTTGTGACTCAC[A/G]GAATAAAATGAAGGAGCTGGAGCTTCTCTGTTCGCTRAAGGAGGTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Nonsense 748 1044 16 20
Genomic Location:
Chromosome 7 (position 74644943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCTCCGCAGGAGTGAGGAGCAGTGTCTGGTGCGCAGCGGTCTGGTT[C/T]AGCTCATGGATCGCCTCTGCAGTCTGAGCAGTCAGAGAGACTGCAGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Nonsense 996 1044 19 20
Genomic Location:
Chromosome 7 (position 74640635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGACGGAAAACTCTCCATATTCATCCATAAGAGAGAAGACCAGTCGT[C/A]GCACGAGGTGCTGCAGCCTCTGCTCAGGTAAACACAGGCAATACGACCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pfea5d9u