LOC100332623

Ensembl ID:
ENSDARG00000079129
Human Orthologue:
OPN4
Human Description:
opsin 4 [Source:HGNC Symbol;Acc:14449]
Mouse Orthologue:
Opn4
Mouse Description:
opsin 4 (melanopsin) Gene [Source:MGI Symbol;Acc:MGI:1353425]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34803 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073617 Essential Splice Site 377 492 9 9
Genomic Location (Zv9):
Chromosome 10 (position 1297172)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1300125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTCTATGTTTTGATGAAGTGATTGATTGAAGTGTTTTGTTTTCTACA[G/A]TCTGCAATCACGGACAGTGGCGGCTCCTTGAGCGGCGGAGGCCTTGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link