becn1

Ensembl ID:
ENSDARG00000079128
ZFIN ID:
ZDB-GENE-040426-1666
Description:
beclin 1 [Source:RefSeq peptide;Acc:NP_957166]
Human Orthologue:
BECN1
Human Description:
beclin 1, autophagy related [Source:HGNC Symbol;Acc:1034]
Mouse Orthologue:
Becn1
Mouse Description:
beclin 1, autophagy related Gene [Source:MGI Symbol;Acc:MGI:1891828]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115237 Nonsense 92 384 3 9
ENSDART00000132985 Nonsense 41 111 1 2
ENSDART00000143401 None None 223 None 5
Genomic Location:
Chromosome 12 (position 15555980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACACATTATTGGACCACTTGGACACACAACTCAACATCACTGAGAAC[G/T]AGTGCCAGAATTACAAGTCAGTAACACACAATAACATCAATTACTGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/utye67le