si:dkey-1b17.7

Ensembl ID:
ENSDARG00000079127
ZFIN ID:
ZDB-GENE-050208-624
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVU2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6692 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106546 Nonsense 214 371 4 4
ENSDART00000135397 Nonsense 214 282 4 4
Genomic Location (Zv9):
Chromosome 22 (position 2868228)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1681076
KASP Assay ID:
554-4640.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACGTGTCCTCAGTGTGGGAAGAACTTCTCAAAACCATCCAACCTCTA[T/A]TTAMATCTGAAGATCCACACTGGAGAGAAACCGCACAAGTGCGATCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link