ikbkb

Ensembl ID:
ENSDARG00000079123
ZFIN ID:
ZDB-GENE-071115-2
Description:
inhibitor of nuclear factor kappa-B kinase subunit beta [Source:RefSeq peptide;Acc:NP_001116737]
Human Orthologue:
IKBKB
Human Description:
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta [Source:HGNC Symbol;Acc:5
Mouse Orthologue:
Ikbkb
Mouse Description:
inhibitor of kappaB kinase beta Gene [Source:MGI Symbol;Acc:MGI:1338071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41101 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113613 Essential Splice Site 607 779 16 21
ENSDART00000140265 Essential Splice Site 607 779 17 22

The following transcripts of ENSDARG00000079123 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2554022)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2320411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGAAGGCCATGGAGCTCTTCCGTAAACTCAGAGAGAAACCCAGAGG[T/A]AAGACGCAGGTTTTCAGCATCATCATGAGCGTGTGTGTGTGTGATCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link