cluap1

Ensembl ID:
ENSDARG00000079110
ZFIN ID:
ZDB-GENE-040426-1943
Description:
Clusterin-associated protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVC2]
Human Orthologue:
CLUAP1
Human Description:
clusterin associated protein 1 [Source:HGNC Symbol;Acc:19009]
Mouse Orthologue:
Cluap1
Mouse Description:
clusterin associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1924029]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5703 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa5703
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111623 Essential Splice Site None 427 2 12
ENSDART00000134152 None None 184 None 6
ENSDART00000111623 Essential Splice Site None 427 2 12
ENSDART00000134152 None None 184 None 6

The following transcripts of ENSDARG00000079110 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 38997095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTTTACGTTTTGWTAATGAAATGTGTATTCATTCTTCTTGTCTWAT[A/T]GGTGACAGTTGTGTGTTTACTGGATTAAAGGACAGCAATCATGTCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zyo39gh6