cluap1

Ensembl ID:
ENSDARG00000079110
ZFIN ID:
ZDB-GENE-040426-1943
Description:
Clusterin-associated protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVC2]
Human Orthologue:
CLUAP1
Human Description:
clusterin associated protein 1 [Source:HGNC Symbol;Acc:19009]
Mouse Orthologue:
Cluap1
Mouse Description:
clusterin associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1924029]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5703 Essential Splice Site F2 line generated During 2016
sa44181 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5703
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111623 Essential Splice Site None 427 2 12
ENSDART00000134152   None 184 None 6
ENSDART00000111623 Essential Splice Site None 427 2 12
ENSDART00000134152   None 184 None 6

The following transcripts of ENSDARG00000079110 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 38997095)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37595991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTTTACGTTTTGWTAATGAAATGTGTATTCATTCTTCTTGTCTWAT[A/T]GGTGACAGTTGTGTGTTTACTGGATTAAAGGACAGCAATCATGTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111623 Essential Splice Site 8 427 3 12
ENSDART00000134152   None 184 None 6

The following transcripts of ENSDARG00000079110 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 38996121)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37595017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAATGTTTTGATGGTTTTAAATATCTTTTCAATTTTTATCCATATGTA[G/A]ATTTTACAGAGATGATGCGAGCGCTTGGCTACCCTCGACTCATTTCCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link