KCNT1 (1 of 2)

Ensembl ID:
ENSDARG00000079098
Description:
potassium channel, subfamily T, member 1 [Source:HGNC Symbol;Acc:18865]
Human Orthologue:
KCNT1
Human Description:
potassium channel, subfamily T, member 1 [Source:HGNC Symbol;Acc:18865]
Mouse Orthologue:
Kcnt1
Mouse Description:
potassium channel, subfamily T, member 1 Gene [Source:MGI Symbol;Acc:MGI:1924627]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24778 Nonsense Available for shipment Available now
sa24777 Nonsense Available for shipment Available now
sa44416 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109046 Nonsense 199 965 8 27
Genomic Location (Zv9):
Chromosome Zv9_NA672 (position 49163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64833290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCTGCCATGTTCAACCAGGTCCTCATCCTGATCTGTACACTGCTCTG[T/A]CTGGTCTTCACCGGGTAAAGCTCTGATCTCTCATAACCCTGATGGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109046 Nonsense 322 965 11 27
Genomic Location (Zv9):
Chromosome Zv9_NA672 (position 39782)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64841168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGTGATCCAGCTGATAAAGGTGTCTCGAATGTCATGTAGGACTATTA[T/A]GTGGTGATCCTCTGTCCCACGGAGATGGACATCCAGGTGCGGCGAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109046 Nonsense 405 965 14 27
Genomic Location (Zv9):
Chromosome Zv9_NA672 (position 33197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64852209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTGCGAGCCTGGGCTGTGAAGGATTTTGCTCCAAACTGTCCTCTTTA[T/A]GTCCAGATCCTCAAACCCGAGAACAAATTTCATGTCAAATTTGCAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link