tanc2

Ensembl ID:
ENSDARG00000079097
ZFIN ID:
ZDB-GENE-060130-180
Description:
LOC568810 protein [Source:UniProtKB/TrEMBL;Acc:A8WGB7]
Human Orthologue:
TANC2
Human Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 [Source:HGNC Symbol;Acc:30212]
Mouse Orthologue:
Tanc2
Mouse Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19991 Nonsense Mutation detected in F1 DNA During 2014
sa13429 Essential Splice Site Available for shipment Available now
sa10844 Nonsense Available for shipment Available now
sa19992 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112270 Nonsense 405 1903 7 23
ENSDART00000125583 Nonsense 487 1985 9 25

The following transcripts of ENSDARG00000079097 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23079336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGTACACATGCCTGGTGCCAGAGTTTGTGCACAATGTGGCAGCATTGT[T/A]GTGCAGGGCACCTCAGATGCAGGCCTACAGAGATCTTCTGCTCCGCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112270 Essential Splice Site 751 1903 11 23
ENSDART00000125583 Essential Splice Site 833 1985 13 25

The following transcripts of ENSDARG00000079097 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23081915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGACCCTTGAACTTGGCCACCACATTCTCAAAGCTCACATCTTTAAG[G/A]TTAGATCAACAAAACAACCTTTACCTGTTTTKAGCTTTCYTAAACTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112270 Nonsense 1248 1903 22 23
ENSDART00000125583 Nonsense 1330 1985 24 25

The following transcripts of ENSDARG00000079097 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23099515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCAGGACTTTGGGATGGCGGAGGAGTTTGCCTCCAAGGCACTAGAGT[T/A]GAAACCCAAATCCTATGAAGCCTATTACGCACGAGCCCGTGCCAAGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112270 Nonsense 1873 1903 23 23
ENSDART00000125583 Nonsense 1955 1985 25 25

The following transcripts of ENSDARG00000079097 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 23104619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTACCCAGATGTGAAAATGGCACGGACTCTGCCAGTTTCCCAGGCCTAC[C/T]AGGACAATGAGTTTAGGCAGATGTCTCGAAGTGAAAGGCAAGGTCCGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jglazqos