si:ch73-173k21.1

Ensembl ID:
ENSDARG00000079074
ZFIN ID:
ZDB-GENE-090313-137
Human Orthologue:
FRMPD1
Human Description:
FERM and PDZ domain containing 1 [Source:HGNC Symbol;Acc:29159]
Mouse Orthologue:
Frmpd1
Mouse Description:
FERM and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446274]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19485 Nonsense Available for shipment Available now
sa15183 Nonsense Available for shipment Available now
sa39603 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32657 Nonsense Available for shipment Available now
sa19484 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 187 1757 6 15
ENSDART00000139937   None 122 None 3
ENSDART00000140553 Nonsense 49 267 2 7
Genomic Location (Zv9):
Chromosome 1 (position 20734977)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21207073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTCCAGGGCAATTCTCTGCTGTTCCTGCCTAATGTTCTGAAGGTCTA[T/A]CTGGAGAACGGCCAAACGAAGGCTTTCAAGTTTGAATCTAAAACCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 230 1757 7 15
ENSDART00000139937   None 122 None 3
ENSDART00000140553 Nonsense 92 267 3 7
Genomic Location (Zv9):
Chromosome 1 (position 20731945)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21204041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACTGTCAATAACCCGTATAGAACACTTCTCYCTAGTACTGGAACAA[C/T]AATACAGCATMAGCAAACTCTATCTACTGCATGAGGAAGAGATTATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Essential Splice Site 287 1757 8 15
ENSDART00000139937   None 122 None 3
ENSDART00000140553 Essential Splice Site 149 267 4 7
Genomic Location (Zv9):
Chromosome 1 (position 20730343)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21202439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCATGCTTACAGAAGATCCTGTGGGCTTTGAGTATCTGTACTTACAG[G/A]TGAGTGTTTCTTTCATGTTAGTTTCCTGCTATAACCACTAGTAAATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 755 1757 14 15
ENSDART00000139937   None 122 None 3
ENSDART00000140553   None 267 None 7
Genomic Location (Zv9):
Chromosome 1 (position 20721664)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21193760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCTGAATGTCTACCTAGTCCCCCTGCAGCCAGCGAAGAGGAAGACTG[T/A]GAGGAGTCAGGAATAGAGAATGAAAACCATAAAAAGGAGTCACCTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 790 1757 14 15
ENSDART00000139937   None 122 None 3
ENSDART00000140553   None 267 None 7
Genomic Location (Zv9):
Chromosome 1 (position 20721561)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21193657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTGAAAGCAACCTACCCCTTCCTGCAGATTATGTGTTCACATTTGAA[C/T]AAGGAGACACTAGACATTACTACAATATCTGCTCCAATGTTACTCCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link