jam2b

Ensembl ID:
ENSDARG00000079071
ZFIN ID:
ZDB-GENE-080229-3
Description:
junctional adhesion molecule 2 [Source:RefSeq peptide;Acc:NP_001121766]
Human Orthologue:
JAM2
Human Description:
junctional adhesion molecule 2 [Source:HGNC Symbol;Acc:14686]
Mouse Orthologue:
Jam2
Mouse Description:
junction adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1933820]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111437 Nonsense 15 306 1 10

The following transcripts of ENSDARG00000079071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35967625)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35187136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCACATGCTCCTGCAGCAGCCGTACATCACGAAGATGAAAACAAAA[C/T]AACTACTAACCTCTGCTCTTCTCCTGCTTATTTACAGTAAGTATCATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link