DOCK9 (3 of 3)

Ensembl ID:
ENSDARG00000079069
Description:
dedicator of cytokinesis 9 [Source:HGNC Symbol;Acc:14132]
Human Orthologue:
DOCK9
Human Description:
dedicator of cytokinesis 9 [Source:HGNC Symbol;Acc:14132]
Mouse Orthologue:
Dock9
Mouse Description:
dedicator of cytokinesis 9 Gene [Source:MGI Symbol;Acc:MGI:106321]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21413 Nonsense Available for shipment Available now
sa27315 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7169 Nonsense Mutation detected in F1 DNA During 2017
sa34539 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 147 1207 5 32
Genomic Location (Zv9):
Chromosome 9 (position 1248931)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1258085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACTGCAATGATCTGTCCTTCAACCTGCAGAGCTGTGTGGCGGAGAAT[G/T]AAGAGGGGCCGACCACTAACGTAACTCACCAACACACCACACTGAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Essential Splice Site 214 1207 6 32
Genomic Location (Zv9):
Chromosome 9 (position 1249329)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1258483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAGAGAAAACAACCCAGCAGAGAGCGCTGTTCACTACCCACGCCAG[G/A]TCAGACAACACAACACAACACCTGGCCCATAACCGAGAGACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 661 1207 20 32
Genomic Location (Zv9):
Chromosome 9 (position 1266357)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1275511
KASP Assay ID:
554-4447.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTWAAAGCATGTTTCCCCTCATSAATGTGYCAGATCTGCAGCTGGATTA[C/A]TCTCTGACGGATGATTTCTGCAAGAATCACTTTGTGGTGGGTCTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 693 1207 20 32
Genomic Location (Zv9):
Chromosome 9 (position 1266451)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1275605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTGCGGGAGGTGAGCGCAGCCGTGCAGGAGTGCAGAGACATCCGG[C/T]AGATCAGCATAGCAGTGCTCAAAAACCTGATGATCAAACACGCTTTCGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link