ADAM12

Ensembl ID:
ENSDARG00000079068
Description:
ADAM metallopeptidase domain 12 [Source:HGNC Symbol;Acc:190]
Human Orthologue:
ADAM12
Human Description:
ADAM metallopeptidase domain 12 [Source:HGNC Symbol;Acc:190]
Mouse Orthologue:
Adam12
Mouse Description:
a disintegrin and metallopeptidase domain 12 (meltrin alpha) Gene [Source:MGI Symbol;Acc:MGI:105378]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10558 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108736 Nonsense 207 924 6 23
Genomic Location:
Chromosome 17 (position 32442364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACACAACATATCGACTGTCAGCAACACGAACACAAGAGGACTGCTA[C/T]AATCATTCAGAACGAGGGTATGAACGCAATCTGTCAGCAGCGGTTATGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kb6t22nl