LOC563643

Ensembl ID:
ENSDARG00000079067
Human Orthologue:
MMS19
Human Description:
MMS19 nucleotide excision repair homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:13824]
Mouse Orthologue:
Mms19
Mouse Description:
MMS19 (MET18 S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919449]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35180 Nonsense Mutation detected in F1 DNA During 2016
sa35181 Nonsense Mutation detected in F1 DNA During 2016
sa19017 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110766 Nonsense 317 1043 12 32
Genomic Location:
Chromosome 12 (position 3399651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTAGGTTTTCCAGACGGCCAGTGAGAGGGTGGAATCGGCTGGTCTTT[C/A]GGCTCTGAGCTCACTAGTGTCCTGTCTATCCCGTTCTGTGCTTAATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110766 Nonsense 395 1043 13 32
Genomic Location:
Chromosome 12 (position 3401262)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGAGCCAGTCTAATCGGGACGCAGGCCGTCATTCCTGCCTTGCTGGAC[C/T]AATACAATAACAGGACACAGGTACAGTCTTGTGCGTACACGCTCAGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110766 Essential Splice Site 555 1043 19 32
Genomic Location:
Chromosome 12 (position 3408082)
KASP Assay ID:
2260-4803.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAAAATTGTAGCTCTTTAATATGTGATGTTGCTGTACTCTTCTTTACA[G/T]ATGAGTGTAGTGGTGCAGTACGTCGGCGGTGTGTTGCAGCTTTAGCGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link