LOC563643

Ensembl ID:
ENSDARG00000079067
Human Orthologue:
MMS19
Human Description:
MMS19 nucleotide excision repair homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:13824]
Mouse Orthologue:
Mms19
Mouse Description:
MMS19 (MET18 S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919449]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19017 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110766 Essential Splice Site 555 1043 19 32
Genomic Location:
Chromosome 12 (position 3408082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAAAATTGTAGCTCTTTAATATGTGATGTTGCTGTACTCTTCTTTACA[G/T]ATGAGTGTAGTGGTGCAGTACGTCGGCGGTGTGTTGCAGCTTTAGCGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pzfh0b3z