LOC563643

Ensembl ID:
ENSDARG00000079067
Human Orthologue:
MMS19
Human Description:
MMS19 nucleotide excision repair homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:13824]
Mouse Orthologue:
Mms19
Mouse Description:
MMS19 (MET18 S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919449]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35180 Nonsense Mutation detected in F1 DNA During 2016
sa35181 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110766 Nonsense 317 1043 12 32
Genomic Location (Zv9):
Chromosome 12 (position 3399651)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2786651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTAGGTTTTCCAGACGGCCAGTGAGAGGGTGGAATCGGCTGGTCTTT[C/A]GGCTCTGAGCTCACTAGTGTCCTGTCTATCCCGTTCTGTGCTTAATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110766 Nonsense 395 1043 13 32
Genomic Location (Zv9):
Chromosome 12 (position 3401262)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2788262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGAGCCAGTCTAATCGGGACGCAGGCCGTCATTCCTGCCTTGCTGGAC[C/T]AATACAATAACAGGACACAGGTACAGTCTTGTGCGTACACGCTCAGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link