ENSDARG00000079066

Ensembl ID:
ENSDARG00000079066
Human Orthologues:
THBS1, THBS2
Human Descriptions:
thrombospondin 1 [Source:HGNC Symbol;Acc:11785]
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Mouse Orthologues:
Thbs1, Thbs2
Mouse Descriptions:
thrombospondin 1 Gene [Source:MGI Symbol;Acc:MGI:98737]
thrombospondin 2 Gene [Source:MGI Symbol;Acc:MGI:98738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4002 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109526 Nonsense 122 331 2 7
Genomic Location:
Chromosome 17 (position 297344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGGAAGGCCAACACGCTGGATCTGGTGTTCTGGAGCGCCRGCGGGCAG[C/T]AGGTGGTGTCGGTGGAGGATGTGGAGCTGGCGGACGGACACTGGAGGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ziqfwrz