limch1

Ensembl ID:
ENSDARG00000079060
ZFIN ID:
ZDB-GENE-030131-9210
Description:
LIM and calponin homology domains-containing protein 1 [Source:RefSeq peptide;Acc:NP_001108201]
Human Orthologue:
LIMCH1
Human Description:
LIM and calponin homology domains 1 [Source:HGNC Symbol;Acc:29191]
Mouse Orthologue:
Limch1
Mouse Description:
LIM and calponin homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1924819]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13111 Essential Splice Site Available for shipment Available now
sa10987 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110570 Essential Splice Site 95 1020 3 26
ENSDART00000126283 Essential Splice Site 50 975 3 26
Genomic Location:
Chromosome 14 (position 14671895)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTCTGGTGAAGAAGATAAACAGACTGCCCACTCCTGTAGCTGCTCAG[G/A]TAAGTTTCTGTTTACTTGCCCAGGCCTTGTCTAAGCATTTTTGTAAWGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110570 Nonsense 182 1020 7 26
ENSDART00000126283 Nonsense 137 975 7 26
Genomic Location:
Chromosome 14 (position 14707645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTATATTGTTTATATGTGCTTGTTTTTGTMAGGAAGCAGAAGAGTG[G/A]GACAGCCCGAAGCGTAGCATCAGGGACAGTGGTTATATAGACTGCTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lysjf9t9