limch1

Ensembl ID:
ENSDARG00000079060
ZFIN ID:
ZDB-GENE-030131-9210
Description:
LIM and calponin homology domains-containing protein 1 [Source:RefSeq peptide;Acc:NP_001108201]
Human Orthologue:
LIMCH1
Human Description:
LIM and calponin homology domains 1 [Source:HGNC Symbol;Acc:29191]
Mouse Orthologue:
Limch1
Mouse Description:
LIM and calponin homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1924819]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13111 Essential Splice Site Available for shipment Available now
sa10987 Nonsense Available for shipment Available now
sa35656 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110570 Essential Splice Site 95 1020 3 26
ENSDART00000126283 Essential Splice Site 50 975 3 26
Genomic Location (Zv9):
Chromosome 14 (position 14671895)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16611918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTCTGGTGAAGAAGATAAACAGACTGCCCACTCCTGTAGCTGCTCAG[G/A]TAAGTTTCTGTTTACTTGCCCAGGCCTTGTCTAAGCATTTTTGTAAWGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110570 Nonsense 182 1020 7 26
ENSDART00000126283 Nonsense 137 975 7 26
Genomic Location (Zv9):
Chromosome 14 (position 14707645)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16647668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTATATTGTTTATATGTGCTTGTTTTTGTMAGGAAGCAGAAGAGTG[G/A]GACAGCCCGAAGCGTAGCATCAGGGACAGTGGTTATATAGACTGCTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110570 Essential Splice Site 328 1020 8 26
ENSDART00000126283 Essential Splice Site 283 975 8 26
Genomic Location (Zv9):
Chromosome 14 (position 14722651)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16662674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTGGAGTAACGCAACCTCACCTGTTGGGGGAGAGAGACCTTTCAGG[T/A]AAATCTAACTGAGATGCTGGTTTGTATGTAGATACAGTGACTGGTTGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link