si:ch211-166e11.5

Ensembl ID:
ENSDARG00000079042
ZFIN ID:
ZDB-GENE-070912-142

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9936 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112682 Nonsense 12 594 1 6
ENSDART00000132750   None 566 None 5
Genomic Location (Zv9):
Chromosome 9 (position 177943)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 306567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGGTCGTGCGATATGACGTCACAGGCGCGAGCCGCGCTCCCGTGTT[T/A]GTGGTTCGGCTGGAGAAAGGTTTGTGTTTTCRAGCGTTTAAAGTGTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link