Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-22d5.2
- Ensembl ID:
- ENSDARG00000079031
- ZFIN ID:
- ZDB-GENE-091204-283
- Human Orthologue:
- AC114947.1
- Human Description:
- Serine/threonine-protein kinase NIM1 [Source:UniProtKB/Swiss-Prot;Acc:Q8IY84]
- Mouse Orthologues:
- E130304F04Rik, E130304F04Rik
- Mouse Descriptions:
- RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]
- RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa23909 | Essential Splice Site | Available for shipment | Available now |
| sa45735 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23909
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000114502 | None | 433 | None | 3 | |
| ENSDART00000145544 | Essential Splice Site | None | 430 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 21 (position 19553729)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 20689218 GRCz11 21 20725854 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAAATATTGTGAGCTGTAGTTTATTTGCCTGCTGGAATCCTATTTTTCA[G/A]CCTTGAAGAGCAGCAGAATGCCTGAAAAGGCCAGACAGCGGCCTACACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45735
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000114502 | Nonsense | 386 | 433 | 3 | 3 |
| ENSDART00000145544 | Nonsense | 386 | 430 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 21 (position 19550191)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 20685680 GRCz11 21 20722316 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTCTCAATAATCAAGGAAAGCGTATTCGGAGTCCTATTAATGGGGTTTA[T/A]CGTATATTATTGCACAGAGTTAAGAGAAACAGAGGAGCAGAGTCTGTGCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
