si:ch211-22d5.2

Ensembl ID:
ENSDARG00000079031
ZFIN ID:
ZDB-GENE-091204-283
Human Orthologue:
AC114947.1
Human Description:
Serine/threonine-protein kinase NIM1 [Source:UniProtKB/Swiss-Prot;Acc:Q8IY84]
Mouse Orthologues:
E130304F04Rik, E130304F04Rik
Mouse Descriptions:
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23909 Essential Splice Site Available for shipment Available now
sa45735 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114502   None 433 None 3
ENSDART00000145544 Essential Splice Site None 430 2 4
Genomic Location (Zv9):
Chromosome 21 (position 19553729)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20689218
GRCz11 21 20725854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAATATTGTGAGCTGTAGTTTATTTGCCTGCTGGAATCCTATTTTTCA[G/A]CCTTGAAGAGCAGCAGAATGCCTGAAAAGGCCAGACAGCGGCCTACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114502 Nonsense 386 433 3 3
ENSDART00000145544 Nonsense 386 430 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19550191)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20685680
GRCz11 21 20722316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCAATAATCAAGGAAAGCGTATTCGGAGTCCTATTAATGGGGTTTA[T/A]CGTATATTATTGCACAGAGTTAAGAGAAACAGAGGAGCAGAGTCTGTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link