dhx32

Ensembl ID:
ENSDARG00000079029
Human Orthologue:
DHX32
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 32 [Source:HGNC Symbol;Acc:16717]
Mouse Orthologue:
Dhx32
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 32 Gene [Source:MGI Symbol;Acc:MGI:2141813]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18186 Nonsense Available for shipment Available now
sa17670 Essential Splice Site Available for shipment Available now
sa8745 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109015 Nonsense 308 732 4 11
Genomic Location (Zv9):
Chromosome 17 (position 32553414)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32395145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCGCTCTGTCTCATGGAGAGCTGGTGCCCGTGTCTCTGTGCCCAAGG[C/T]AAGGTGACAGTCTCTCACYGACTGAGGAGAGCAAAAGCAGGAGAGYCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109015 Essential Splice Site 499 732 7 11
Genomic Location (Zv9):
Chromosome 17 (position 32559001)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32400732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTTGACTGTGTGTGTGAAGTGCTGACCATCGCTGCSATGCTAACAGG[T/A]AATCCTGTCTCAGTACAATCCACTCGACAGGTGTGTCACCATGTGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109015 Essential Splice Site 546 732 9 11
Genomic Location (Zv9):
Chromosome 17 (position 32562867)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32404598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRTATCAATTGTCATATATYGTGTGGATTTCACGTTCAYATTTGTATTTC[A/T]GACTCTAAAGTGGAGCAGTGGTGTGATGAGCATTTCCTAAGTCTGGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link