RPS6KL1

Ensembl ID:
ENSDARG00000079024
Description:
ribosomal protein S6 kinase-like 1 [Source:HGNC Symbol;Acc:20222]
Human Orthologue:
RPS6KL1
Human Description:
ribosomal protein S6 kinase-like 1 [Source:HGNC Symbol;Acc:20222]
Mouse Orthologue:
Rps6kl1
Mouse Description:
ribosomal protein S6 kinase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443413]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25049 Nonsense Mutation detected in F1 DNA During 2014
sa8751 Nonsense Mutation detected in F1 DNA During 2014
sa14314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109478 Nonsense 180 690 6 10
Genomic Location:
Chromosome 17 (position 53095093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCGATCTTCAACCGTGTACGGTTTGATGGCTTTGCTTTCCCACAGGT[G/T]GAAGACTCTTCTCCAGACTCCACAGGGTCAGAAGTGAAGCAATCCGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109478 Nonsense 197 690 6 10
Genomic Location:
Chromosome 17 (position 53095040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCTTCTCCAGACTCCACAGGGTCAGAAGYGAAGCAATCCGAGAGTA[T/A]CCAGAGTGCTTCAGCCCCAACCAGCATAAGAYCTACCTGAAGAACAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109478 Nonsense 207 690 6 10
Genomic Location:
Chromosome 17 (position 53095012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGYGAAGCAATCCGAGAGTAWCCAGAGTGCTTCAGCCCCAACCAGCAT[A/T]AGAYCTACCTGAAGAACAGCTACACCCTCCCTGTCCTCCGCCAGAAYACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/soweqcjv