brca2

Ensembl ID:
ENSDARG00000079015
ZFIN ID:
ZDB-GENE-060510-3
Description:
breast cancer 2, early onset [Source:RefSeq peptide;Acc:NP_001103864]
Human Orthologue:
BRCA2
Human Description:
breast cancer 2, early onset [Source:HGNC Symbol;Acc:1101]
Mouse Orthologue:
Brca2
Mouse Description:
breast cancer 2 Gene [Source:MGI Symbol;Acc:MGI:109337]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6385 Nonsense Mutation detected in F1 DNA During 2014
sa6386 Nonsense Mutation detected in F1 DNA During 2014
sa22682 Nonsense Mutation detected in F1 DNA During 2014
sa22683 Nonsense Available for shipment Available now
sa7764 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 796 2874 11 27
Genomic Location:
Chromosome 15 (position 31164616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGATGTTACAGAATTGTGCAGTCTTTTAGAGGAAGCAAATAGTCAGTA[T/A]GAATTTACCCAGTACAAATCAACAAATATTGGCTCACACAACCGCACWAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1261 2874 11 27
Genomic Location:
Chromosome 15 (position 31166009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCAGTACAGCAAGTGGTAAGAAGGTGTCCGTCTCARCTGAAGCACTA[C/T]AACGWGCAAAAGATGTGTTGTTTGAATCAGTTGATGGTTTCTCGTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1336 2874 11 27
Genomic Location:
Chromosome 15 (position 31166234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAAAGAATCTCTTCAGAGGCTGTGAGGAGGAAAGTTTAACTACTGAA[C/T]AAAACTGTAAAGGTCTCAGCAATGTCTTAATGCTGGCTTGCAATGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1845 2874 12 27
Genomic Location:
Chromosome 15 (position 31167847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTTGTCTTTTTCCTTTGCTAAATACACTCTTTTGTTCAGATTCAGGT[C/T]AGCCTCCTTTGAAAAGACAACTTCTCTCTGAGTTTGACCGAACATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Essential Splice Site 2583 2874 23 27
Genomic Location:
Chromosome 15 (position 31171179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAYATCCAGCTCACTGCCACCAAGAAAAYACTTTTTCAAGATATTGAG[G/A]TAAACTAAATGTTTATTATTATTATTATMATTRTTATTACTATTATTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/770bnak0