brca2

Ensembl ID:
ENSDARG00000079015
ZFIN ID:
ZDB-GENE-060510-3
Description:
breast cancer 2, early onset [Source:RefSeq peptide;Acc:NP_001103864]
Human Orthologue:
BRCA2
Human Description:
breast cancer 2, early onset [Source:HGNC Symbol;Acc:1101]
Mouse Orthologue:
Brca2
Mouse Description:
breast cancer 2 Gene [Source:MGI Symbol;Acc:MGI:109337]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42579 Nonsense Mutation detected in F1 DNA During 2016
sa6385 Nonsense Mutation detected in F1 DNA During 2016
sa6386 Nonsense Mutation detected in F1 DNA During 2016
sa22682 Nonsense Available for shipment Available now
sa28493 Nonsense Mutation detected in F1 DNA During 2016
sa22683 Nonsense Available for shipment Available now
sa35929 Essential Splice Site Available for shipment Available now
sa35930 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35931 Nonsense Mutation detected in F1 DNA During 2016
sa32050 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 347 2874 10 27
Genomic Location (Zv9):
Chromosome 15 (position 31163186)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32058838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAATGGACCCCACTAAGTTTATCAGAGACCATACTGACCGAAGGTTG[T/A]TCAAGTACTTCTTTGGTAGACAATAACAACACGGTGGCACCCAGTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 796 2874 11 27
Genomic Location (Zv9):
Chromosome 15 (position 31164616)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32060268
KASP Assay ID:
554-4574.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGATGTTACAGAATTGTGCAGTCTTTTAGAGGAAGCAAATAGTCAGTA[T/A]GAATTTACCCAGTACAAATCAACAAATATTGGCTCACACAACCGCACWAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1261 2874 11 27
Genomic Location (Zv9):
Chromosome 15 (position 31166009)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32061661
KASP Assay ID:
554-5057.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCAGTACAGCAAGTGGTAAGAAGGTGTCCGTCTCARCTGAAGCACTA[C/T]AACGWGCAAAAGATGTGTTGTTTGAATCAGTTGATGGTTTCTCGTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1336 2874 11 27
Genomic Location (Zv9):
Chromosome 15 (position 31166234)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32061886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAAAGAATCTCTTCAGAGGCTGTGAGGAGGAAAGTTTAACTACTGAA[C/T]AAAACTGTAAAGGTCTCAGCAATGTCTTAATGCTGGCTTGCAATGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1567 2874 11 27
Genomic Location (Zv9):
Chromosome 15 (position 31166928)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32062580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATGCCAAACAACAACAACAACTTTAAAGATTGTGAAGAGGAGAGTT[T/G]AGCTTCTAGAAATCTTATGCACCAAGCCTGTAAAGGCTTCACCACTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 1845 2874 12 27
Genomic Location (Zv9):
Chromosome 15 (position 31167847)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32063499
KASP Assay ID:
2260-8731.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTTGTCTTTTTCCTTTGCTAAATACACTCTTTTGTTCAGATTCAGGT[C/T]AGCCTCCTTTGAAAAGACAACTTCTCTCTGAGTTTGACCGAACATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Essential Splice Site 2204 2874 17 27
Genomic Location (Zv9):
Chromosome 15 (position 31169462)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32065114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGCCTGTGTTTGACCCCAGAGCAAGTACTTCTACAGCTAAAATTCAG[G/A]TACTGAGAATTAGTAAAGCTCATACTTTTTTTCATCTCAACCTTTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Essential Splice Site 2424 2874 20 27
Genomic Location (Zv9):
Chromosome 15 (position 31170364)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32066016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTCCTAATTTCCAAAATTCAGACCCAATTTGAAAAAGAAATGGAGGG[T/C]AGGGATTGCATTATCTTCTTTTTCTGACATTAAACTTGATCAAAGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Nonsense 2650 2874 25 27
Genomic Location (Zv9):
Chromosome 15 (position 31172180)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32067832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACTGCATCTTGTGGATGAGAACTTTGACCTGGTCACTGTGAGAACCTA[C/A]AGTAGTCTGGAGCAGTTAGCAGTTGAAGAGCTTGTAAAGCCACGAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111472 Essential Splice Site 2756 2874 26 27
Genomic Location (Zv9):
Chromosome 15 (position 31172590)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32068242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCCAAGAACTCCTGGTGTGCAGCCTTTTCCAAAAATGAATGGCACGG[T/G]GCGTGAGTTTTCTTTTGTGTGGTGAAAGATTGGTTTTATTAGTGGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link