B6E448_DANRE

Ensembl ID:
ENSDARG00000079014
Description:
Semaphorin 4f [Source:UniProtKB/TrEMBL;Acc:B6E448]
Human Orthologue:
SEMA4F
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4f
Mouse Description:
sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain Gene [Source:MGI Sy

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34223 Nonsense Mutation detected in F1 DNA During 2016
sa15002 Nonsense Available for shipment Available now
sa7607 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126930 Nonsense 98 414 4 12
Genomic Location (Zv9):
Chromosome 7 (position 65958531)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59140271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGTCATGCTTTACTCTGCTGCCCCTTACAGGATGACTGCAGGAATTA[T/A]GTTCGTTTGCTGGAGTTTTTGGACGATGGCCGCATATATGCCTGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126930 Nonsense 135 414 5 12
Genomic Location (Zv9):
Chromosome 7 (position 65959711)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59141451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTTGTCTWACTTGTTACAGAACATCTCTACATTCTCTCTGGAGAWA[C/T]AGGATGATGGTTTTATAAAGATGGAGACCGGGAAGGGGAAATGCCCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126930 Missense 191 414 6 12
Genomic Location (Zv9):
Chromosome 7 (position 65960175)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59141915
KASP Assay ID:
554-4258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTGGCACAATGTATGACATTTCCAGAGCAACAGGCATCGAGCAGGAA[C/T]GCATCCGAACTGAGCAATCAATCAACTGGCTTAGTGGTAAGATACTAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link