B6E448_DANRE

Ensembl ID:
ENSDARG00000079014
Description:
Semaphorin 4f [Source:UniProtKB/TrEMBL;Acc:B6E448]
Human Orthologue:
SEMA4F
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4f
Mouse Description:
sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15002 Nonsense Available for shipment Available now
sa7607 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126930 Nonsense 135 414 5 12
Genomic Location:
Chromosome 7 (position 65959711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTTGTCTWACTTGTTACAGAACATCTCTACATTCTCTCTGGAGAWA[C/T]AGGATGATGGTTTTATAAAGATGGAGACCGGGAAGGGGAAATGCCCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126930 Missense 191 414 6 12
Genomic Location:
Chromosome 7 (position 65960175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTGGCACAATGTATGACATTTCCAGAGCAACAGGCATCGAGCAGGAA[C/T]GCATCCGAACTGAGCAATCAATCAACTGGCTTAGTGGTAAGATACTAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wkooxjbn