LOC796987

Ensembl ID:
ENSDARG00000079013
Human Orthologue:
DPY19L3
Human Description:
dpy-19-like 3 (C. elegans) [Source:HGNC Symbol;Acc:27120]
Mouse Orthologue:
Dpy19l3
Mouse Description:
dpy-19-like 3 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2443952]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14617 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114669 Nonsense 634 725 17 18
Genomic Location:
Chromosome 7 (position 48868738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCTGCCGAGGAGGTTCATAAAGTGCTGGGTTCGGYTGGAACAGACTA[C/A]ATTGTGCTGGAGGACAGCATCTGCTATGAGCGCAGGCACAGCCGTGGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association study of bipolar disorder in European American and African American individuals. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/duf626c0