LOC796987

Ensembl ID:
ENSDARG00000079013
Human Orthologue:
DPY19L3
Human Description:
dpy-19-like 3 (C. elegans) [Source:HGNC Symbol;Acc:27120]
Mouse Orthologue:
Dpy19l3
Mouse Description:
dpy-19-like 3 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2443952]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40990 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34164 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa14617 Nonsense Available for shipment Available now
sa31590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114669 Essential Splice Site 109 725 3 18
Genomic Location (Zv9):
Chromosome 7 (position 48765309)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47032928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTACTCCTACTACAAACAGATGCTGAAGGCCCCTACTATACAGCAAG[G/A]TACTGAGATTTACTCTCAAGACATATTGACTAGTTTTATGATCAATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114669 Splice Site, Nonsense 610 725 16 18
Genomic Location (Zv9):
Chromosome 7 (position 48817791)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47085410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAAACCATCCACACTACGAGGACCAGGCGCTCAGGGAGAGGACCAGA[C/T]AGGTAAGAGGCTCAGATTTGTTTTCACAATCAGTAAGTTTGCTTGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114669 Nonsense 634 725 17 18
Genomic Location (Zv9):
Chromosome 7 (position 48868738)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47136357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCTGCCGAGGAGGTTCATAAAGTGCTGGGTTCGGYTGGAACAGACTA[C/A]ATTGTGCTGGAGGACAGCATCTGCTATGAGCGCAGGCACAGCCGTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114669 Nonsense 643 725 17 18
Genomic Location (Zv9):
Chromosome 7 (position 48868765)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47136384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTTCGGTTGGAACAGACTACATTGTGCTGGAGGACAGCATCTGCTA[T/A]GAGCGCAGGCACAGCCGTGGCTGTAGGCTGAGGGACCTGCTCGACCTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association study of bipolar disorder in European American and African American individuals. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link