LOC563252

Ensembl ID:
ENSDARG00000079012
Human Orthologue:
CBFA2T3
Human Description:
core-binding factor, runt domain, alpha subunit 2; translocated to, 3 [Source:HGNC Symbol;Acc:1537]
Mouse Orthologue:
Cbfa2t3
Mouse Description:
core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) Gene [Source:MGI Symbo

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1754 Nonsense Available for shipment Available now
sa3621 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021009 Nonsense 188 598 4 11
Genomic Location:
Chromosome 7 (position 56934812)
KASP Assay ID:
554-1747.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTCACTGTGCTCGGATGGCTAAGCAGACCCCAGCCCAGTATCTGGCC[C/T]AACATGAACAGCTTCTGCTGGATGCCAATGCCATCTCTCCCCTGGACTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021009 Essential Splice Site 344 598 6 11
Genomic Location:
Chromosome 7 (position 56932735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGGCTGACAGACCGCGAGTGGGCTGAGGAATGGAAGCACCTCGATAAC[G/A]TATGTGTGACCAGATGCTTTACANTTTTAACATMTTTCATACATACTGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dim8kokr