LOC563252

Ensembl ID:
ENSDARG00000079012
Human Orthologue:
CBFA2T3
Human Description:
core-binding factor, runt domain, alpha subunit 2; translocated to, 3 [Source:HGNC Symbol;Acc:1537]
Mouse Orthologue:
Cbfa2t3
Mouse Description:
core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) Gene [Source:MGI Symbo

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1754 Nonsense Available for shipment Available now
sa3621 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38643 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021009 Nonsense 188 598 4 11
Genomic Location:
Chromosome 7 (position 56934812)
KASP Assay ID:
554-1747.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTCACTGTGCTCGGATGGCTAAGCAGACCCCAGCCCAGTATCTGGCC[C/T]AACATGAACAGCTTCTGCTGGATGCCAATGCCATCTCTCCCCTGGACTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021009 Essential Splice Site 344 598 6 11
Genomic Location:
Chromosome 7 (position 56932735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGGCTGACAGACCGCGAGTGGGCTGAGGAATGGAAGCACCTCGATAAC[G/A]TATGTGTGACCAGATGCTTTACANTTTTAACATMTTTCATACATACTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021009 Essential Splice Site 420 598 7 11
Genomic Location:
Chromosome 7 (position 56931823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTCTTCCTCCTCCAACACTCCTAACAGCAGCGAAACACAGCCGCTAG[G/A]TACATGCACCGCTGCAGATGCAGCCACAGGCGCAGATGCTTGGCACGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link