col17a1b

Ensembl ID:
ENSDARG00000079011
ZFIN ID:
ZDB-GENE-030131-7145
Description:
Novel protein similar to vertebrate collagen, type XVII, alpha 1 (COL17A1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
COL17A1
Human Description:
collagen, type XVII, alpha 1 [Source:HGNC Symbol;Acc:2194]
Mouse Orthologue:
Col17a1
Mouse Description:
collagen, type XVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88450]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6300 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22298 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18664 Essential Splice Site Available for shipment Available now
sa22299 Nonsense Mutation detected in F1 DNA During 2014
sa4504 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 299 1542 9 57
ENSDART00000134102 Essential Splice Site 125 1368 3 51
ENSDART00000137074 None None 170 None 6
Genomic Location:
Chromosome 13 (position 24979723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACYGGAGCTTCACTGATCAGCAGCAGCACATCCCCATCCTCCTTATCAGG[T/C]CTATRTAAATGATCACTTATTTRCTATGTTGACCTGACAAAATGTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 348 1542 11 57
ENSDART00000134102 Essential Splice Site 174 1368 5 51
ENSDART00000137074 Essential Splice Site 50 170 2 6
Genomic Location:
Chromosome 13 (position 24980627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGTCCAGACAGCACTCTTGCAGTCAGCACAGGCATCTCCACTGCAGG[T/C]GTTTGTTTTATTCAACTTAGCATGGACTGGGTTGTACCATGTTCTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 1063 1542 44 57
ENSDART00000134102 Essential Splice Site 889 1368 38 51
ENSDART00000137074 None None 170 None 6
Genomic Location:
Chromosome 13 (position 24995472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGTCCCCCAGGMCCTCCTGGACCACCCGGTCGAGAAGGCCGTAAAG[G/A]TAAAAATMTTGAAWAATGACRAGAACACATTCTGTGCASGTATATTMTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Nonsense 1379 1542 53 57
ENSDART00000134102 Nonsense 1205 1368 47 51
ENSDART00000137074 None None 170 None 6
Genomic Location:
Chromosome 13 (position 24998046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGCGCTATGTCCAAGGGCCACCTGGGCTGCCTGGACCCCCTGGTCAG[A/T]AGGGTGACCGTGGTGAACCTGGGTACAGTTATCAAAATGGCAGAAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Nonsense 1496 1542 55 57
ENSDART00000134102 Nonsense 1322 1368 49 51
ENSDART00000137074 None None 170 None 6
Genomic Location:
Chromosome 13 (position 25000932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCAGGGCCCCCTGGCAGGTCAGGGCCCAAAGGAGAAAGAGGATATCCA[G/T]GACCTAAAGGAARTAAAGGTAMCRTACTAACTGTCATTCACATAAGTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iy9gy41c