TANC2 (2 of 2)

Ensembl ID:
ENSDARG00000079004
Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 [Source:HGNC Symbol;Acc:30212]
Human Orthologue:
TANC2
Human Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 [Source:HGNC Symbol;Acc:30212]
Mouse Orthologue:
Tanc2
Mouse Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19018 Nonsense Mutation detected in F1 DNA During 2014
sa7683 Nonsense Mutation detected in F1 DNA During 2014
sa14210 Essential Splice Site Available for shipment Available now
sa6228 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Nonsense 214 1720 4 28
ENSDART00000109164 Nonsense 214 1720 4 28
Genomic Location:
Chromosome 12 (position 3949597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCTCGCTGCGGATGCCCAGACAGAGCTCCACCGCGGGCCGCTCCGGG[C/T]AGGACCTGCGAGGTGAGAGACTGACCGCCTGTGCTAAGCTTTTATTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Nonsense 214 1720 4 28
ENSDART00000109164 Nonsense 214 1720 4 28
Genomic Location:
Chromosome 12 (position 3949597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCTCGCTGCGGATGCCCAGACAGAGCTCCACCGCRGGCCGCTCCGGG[C/T]AGGACCTGCGAGGTGAGAGACTGACCRCCTGTGCTAAGCTTTYRTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 312 1720 5 28
Genomic Location:
Chromosome 12 (position 3944122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCGCATGAGACAGATCGCCTCCGACAGCCCACAGGCATCGCCAAAACG[T/A]GAGATTCACAAGTCCCCTGTCAGACCRAGTGGCACATTNNNCATTCATTCANN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 939 1720 16 28
Genomic Location:
Chromosome 12 (position 3918932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAACGCGCACAGATTAACWGCTGTGACACCCTGTGGGGTGAAACAG[G/A]TAAATGAGMTTWTTTTTCATGCTATRAATKTGTCTCAAGTGACTGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/br703jfk