si:ch73-182i17.2

Ensembl ID:
ENSDARG00000079002
ZFIN IDs:
ZDB-GENE-040910-7, ZDB-GENE-100921-26
Human Orthologue:
DNAI1
Human Description:
dynein, axonemal, intermediate chain 1 [Source:HGNC Symbol;Acc:2954]
Mouse Orthologue:
Dnaic1
Mouse Description:
dynein, axonemal, intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:1916172]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18389 Nonsense Available for shipment Available now
sa37271 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056647 Nonsense 209 556 9 17
ENSDART00000131444   None 225 None 8
ENSDART00000134914 Nonsense 236 583 10 18
ENSDART00000148114   None 169 None 8

The following transcripts of ENSDARG00000079002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 16865896)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18260059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WAAAAAAAANGTCTCTGCAGTGATTATTTGTGTCTGTTTGTTTCTAGGAAC[A/T]AAAAATACAATGATTTGTTTRCTRTTGGTCTTGGGTCACGTAAGTCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056647 Nonsense 335 556 12 17
ENSDART00000131444   None 225 None 8
ENSDART00000134914 Nonsense 362 583 13 18
ENSDART00000148114   None 169 None 8

The following transcripts of ENSDARG00000079002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 16864027)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18261928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAATCATTACAGTAAGGTTAATTGATCCCAGTCATTTGGATTTCAGTA[T/A]GAGCTATTCTCCACCAATATCATCAAGCTCCCACCAATGGACAAAGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link