LOC100151593

Ensembl ID:
ENSDARG00000078998
Human Orthologue:
LHFPL4
Human Description:
lipoma HMGIC fusion partner-like 4 [Source:HGNC Symbol;Acc:29568]
Mouse Orthologue:
Lhfpl4
Mouse Description:
lipoma HMGIC fusion partner-like protein 4 Gene [Source:MGI Symbol;Acc:MGI:3057108]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13001 Essential Splice Site Available for shipment Available now
sa12986 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108946 Essential Splice Site 136 237 1 4
ENSDART00000108946 Essential Splice Site 136 237 1 4
Genomic Location:
Chromosome 6 (position 23425411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCGCCACCGTCTACAAAACCTGCGCTTGGATGCAGCTGCTTTGTGG[T/C]GAGTATATATATTAGANNNNTGTGGAATGATTACGCTTTTGTTTGMCATACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108946 Essential Splice Site 136 237 1 4
ENSDART00000108946 Essential Splice Site 136 237 1 4
Genomic Location:
Chromosome 6 (position 23425411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCGCCACCGTCTACAAAACCTGCGCTTGGATGCAGCTGCTTTGTGG[T/C]GAGTATATATATTAGANNNNTGTGGAATGATTACGCTTTTGTTTGMCATACTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5nh7bizl