ENSDARG00000078994

Ensembl ID:
ENSDARG00000078994

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15760 Essential Splice Site Available for shipment Available now
sa13859 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112246 Essential Splice Site 357 706 8 18
Genomic Location:
Chromosome 25 (position 8551915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYATCCACATCTCATATCCTGTTTTAAGAATATACCTGTCTTTTCCTGT[A/T]GGAWGCTTGGACTCATCTGGGAAACCACGTAGGGTACTGTATACAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112246 Essential Splice Site 426 706 10 18
Genomic Location:
Chromosome 25 (position 8552312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGCAGTGTTTTAAGACTAAAGCCTCMTCTCACTCTGTTTCATGATGT[A/T]GATTGTAGCATGTGCCCATTTTCGGAGGAAAAGTGTGAGGTYGGATATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4edxkpti