ENSDARG00000078994

Ensembl ID:
ENSDARG00000078994

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15760 Essential Splice Site Available for shipment Available now
sa13859 Essential Splice Site Available for shipment Available now
sa44235 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112246 Essential Splice Site 357 706 8 18
Genomic Location (Zv9):
Chromosome 25 (position 8551915)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8266820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYATCCACATCTCATATCCTGTTTTAAGAATATACCTGTCTTTTCCTGT[A/T]GGAWGCTTGGACTCATCTGGGAAACCACGTAGGGTACTGTATACAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112246 Essential Splice Site 426 706 10 18
Genomic Location (Zv9):
Chromosome 25 (position 8552312)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8267217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGCAGTGTTTTAAGACTAAAGCCTCMTCTCACTCTGTTTCATGATGT[A/T]GATTGTAGCATGTGCCCATTTTCGGAGGAAAAGTGTGAGGTYGGATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112246 Nonsense 441 706 10 18
Genomic Location (Zv9):
Chromosome 25 (position 8552360)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8267265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGATTGTAGCATGTGCCCATTTTCGGAGGAAAAGTGTGAGGTTGGATA[T/A]GAACTGATTGTGCACCCTTACGGAGACTTCTGTCCAGAAATCAGATGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link