ENSDARG00000078992

Ensembl ID:
ENSDARG00000078992
Human Orthologue:
WNK1
Human Description:
WNK lysine deficient protein kinase 1 [Source:HGNC Symbol;Acc:14540]
Mouse Orthologue:
Wnk1
Mouse Description:
WNK lysine deficient protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2442092]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16044 Nonsense Available for shipment Available now
sa16394 Nonsense Available for shipment Available now
sa44298 Nonsense Mutation detected in F1 DNA During 2016
sa38068 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 293 1606 3 23
ENSDART00000086631 Nonsense 293 1606 3 23
Genomic Location:
Chromosome 25 (position 21813200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 293 1606 3 23
ENSDART00000086631 Nonsense 293 1606 3 23
Genomic Location:
Chromosome 25 (position 21813200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 413 1606 4 23
Genomic Location:
Chromosome 25 (position 21811413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACTTCTGAGTACCCGTACTCCGAGTGTCAGAATGCAGCTCAGATCTA[T/A]CGCAGAGTCACCAGCGTAAGTCCACATTTCACTGGCGGAGGAGAGAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 808 1606 13 23
Genomic Location:
Chromosome 25 (position 21797241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTCTGTTTTTATAGATTTCTAATATTGGAGACAGAGTCGCTGAATG[T/A]CAGCTGGAAACCCACAACAGAAAGATGGTCACATTCAAGTTTGATCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link