ENSDARG00000078992

Ensembl ID:
ENSDARG00000078992
Human Orthologue:
WNK1
Human Description:
WNK lysine deficient protein kinase 1 [Source:HGNC Symbol;Acc:14540]
Mouse Orthologue:
Wnk1
Mouse Description:
WNK lysine deficient protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2442092]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16044 Nonsense Available for shipment Available now
sa16394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 293 1606 3 23
ENSDART00000086631 Nonsense 293 1606 3 23
Genomic Location:
Chromosome 25 (position 21813200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 293 1606 3 23
ENSDART00000086631 Nonsense 293 1606 3 23
Genomic Location:
Chromosome 25 (position 21813200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g3wmfjss