Q504G4_DANRE

Ensembl ID:
ENSDARG00000078965
Description:
LOC553422 protein [Source:UniProtKB/TrEMBL;Acc:Q504G4]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21934 Nonsense Available for shipment Available now
sa35107 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066045 Nonsense 120 340 3 7
ENSDART00000079024 Nonsense 120 302 3 8
Genomic Location (Zv9):
Chromosome 11 (position 30502893)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29378879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAAGAAAAAGAAGAAGCCCAGAGAGAAGAAAGAGAGGAAAATGAAA[C/T]AGCGAAAGAAAGAGGATGATGAGGATGAGGACGATGACGATGATGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066045 Essential Splice Site 178 340 4 7
ENSDART00000079024 Essential Splice Site 178 302 4 8
Genomic Location (Zv9):
Chromosome 11 (position 30502635)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29378621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGATTATAAGACTATCACCAACTACAAAGCCTTCAGCCAGTTTCTTAG[G/A]TAGGATTTCAAAGTTTTCCTTCTGCGTGGACGTTCTAATGCCCTGCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link