LOC100330508

Ensembl ID:
ENSDARG00000078964
Human Orthologue:
ESYT2
Human Description:
extended synaptotagmin-like protein 2 [Source:HGNC Symbol;Acc:22211]
Mouse Orthologue:
Esyt2
Mouse Description:
extended synaptotagmin-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:1261845]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa599 Essential Splice Site F2 line generated During 2014
sa11660 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa599
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110789 Essential Splice Site 130 860 2 23
Genomic Location:
Chromosome 7 (position 41549643)
KASP Assay ID:
554-0509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCAGGTTCATTATCCAGATGTGGAGAGAGTTGAGTGGCTTAATAAG[G/A]TGAGCGAATCATAAATTAACATTTGCTTGTCCGTCATCATCTCTAAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110789 Nonsense 334 860 9 23
Genomic Location:
Chromosome 7 (position 41576155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGGATTTATTTTATTGAAGCTCAGAATCTRGAAGTRAAGGACACGTA[T/A]CTTGGCGGACTAATCAAAGGCAAGTCTGACCCATATGGYATGCTGCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p0ve4cbt