LOC100330508

Ensembl ID:
ENSDARG00000078964
Human Orthologue:
ESYT2
Human Description:
extended synaptotagmin-like protein 2 [Source:HGNC Symbol;Acc:22211]
Mouse Orthologue:
Esyt2
Mouse Description:
extended synaptotagmin-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:1261845]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa599 Essential Splice Site F2 line generated During 2016
sa11660 Nonsense Available for shipment Available now
sa31586 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa599
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110789 Essential Splice Site 130 860 2 23
Genomic Location:
Chromosome 7 (position 41549643)
KASP Assay ID:
554-0509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCAGGTTCATTATCCAGATGTGGAGAGAGTTGAGTGGCTTAATAAG[G/A]TGAGCGAATCATAAATTAACATTTGCTTGTCCGTCATCATCTCTAAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110789 Nonsense 334 860 9 23
Genomic Location:
Chromosome 7 (position 41576155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGGATTTATTTTATTGAAGCTCAGAATCTRGAAGTRAAGGACACGTA[T/A]CTTGGCGGACTAATCAAAGGCAAGTCTGACCCATATGGYATGCTGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110789 Splice Site, Nonsense 519 860 15 23
Genomic Location:
Chromosome 7 (position 41581014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCAAATCCTTTTGTCAAACTGACTGTAGGACAGAAGACGTGCACAAGC[A/T]AGGTAGCATTGATTAATCAGCTTTAACATCTTAAAGTCCTGCAATGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link