LOC100330288

Ensembl ID:
ENSDARG00000078962
Human Orthologues:
DUOXA1, DUOXA2
Human Descriptions:
dual oxidase maturation factor 1 [Source:HGNC Symbol;Acc:26507]
dual oxidase maturation factor 2 [Source:HGNC Symbol;Acc:32698]
Mouse Orthologues:
Duoxa1, Duoxa2
Mouse Descriptions:
dual oxidase maturation factor 1 Gene [Source:MGI Symbol;Acc:MGI:2384861]
dual oxidase maturation factor 2 Gene [Source:MGI Symbol;Acc:MGI:1914061]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14365 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110180 Nonsense 82 329 3 7
Genomic Location (Zv9):
Chromosome 25 (position 32930647)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31541591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTGCACTTYAGTGCTTAATTTCACTGGAGACTGGGCTGAAGCCAGAGTG[A/T]AGGCCAACACCACCTACAAATCCTTCAGCACGGCGGTGGTGTCAGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link