rxrba

Ensembl ID:
ENSDARG00000078954
ZFIN ID:
ZDB-GENE-980526-436
Description:
Retinoic acid receptor RXR-beta-A [Source:UniProtKB/Swiss-Prot;Acc:Q7SYN5]
Human Orthologue:
RXRB
Human Description:
retinoid X receptor, beta [Source:HGNC Symbol;Acc:10478]
Mouse Orthologue:
Rxrb
Mouse Description:
retinoid X receptor beta Gene [Source:MGI Symbol;Acc:MGI:98215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43215 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009755 Nonsense 412 471 12 13
ENSDART00000104794   None 106 None 4
ENSDART00000112245 Nonsense 379 438 13 14
ENSDART00000132887   None 261 None 8
ENSDART00000136528 Nonsense 412 471 12 13

The following transcripts of ENSDARG00000078954 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7872875)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7331414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAAGTGGAGTTACTAAGAGAGAAGGTCTATGCATCGCTGGAGGCCTA[T/G]TGTAAACAGAGATATCCTGACCAGCAGGGAAGGTGCACAACATGATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link