EPN3 (2 of 2)

Ensembl ID:
ENSDARG00000078953
Description:
epsin 3 [Source:HGNC Symbol;Acc:18235]
Human Orthologue:
EPN3
Human Description:
epsin 3 [Source:HGNC Symbol;Acc:18235]
Mouse Orthologue:
Epn3
Mouse Description:
epsin 3 Gene [Source:MGI Symbol;Acc:MGI:1919139]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5223 Nonsense Mutation detected in F1 DNA During 2014
sa2135 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063761 Nonsense 101 645 1 10
Genomic Location:
Chromosome 3 (position 47542528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAGACTGGGTCAGAGAGAGTGGCCCAGCAGTGCAAGGAGAACATCTA[C/A]GCCATCCAGACCCTTCGGGACTTTCAGTACATTGACCGGGATGGACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063761 Nonsense 456 645 8 10
Genomic Location:
Chromosome 3 (position 47509329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTCCAGGGGCTGGAGTGGATCCTTTTTCTCCCCCCGTAGTGGACAGA[C/T]GAGGATCTATTGGCCCTCTCAAAACTTCACCCCCTCGTGCAGGAAGTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1mj41mzx