sdccag8

Ensembl ID:
ENSDARG00000078947
ZFIN ID:
ZDB-GENE-090313-318
Description:
Novel protein similar to vertebrate serologically defined colon cancer antigen 8 (SDCCAG8) [Source:U
Human Orthologue:
SDCCAG8
Human Description:
serologically defined colon cancer antigen 8 [Source:HGNC Symbol;Acc:10671]
Mouse Orthologue:
Sdccag8
Mouse Description:
serologically defined colon cancer antigen 8 Gene [Source:MGI Symbol;Acc:MGI:1924066]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38924 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15391 Nonsense Available for shipment Available now
sa18223 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114911 Essential Splice Site 524 701 14 18
ENSDART00000131320   None 86 None 4
ENSDART00000134398 Essential Splice Site 446 524 14 15
ENSDART00000134888   None 101 None 6
ENSDART00000137816   None 197 None 8
ENSDART00000148100   None 186 None 7
Genomic Location (Zv9):
Chromosome 13 (position 10685010)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10987339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGTTTTCTTGCTCTCTCTCTCTCTCTCTTTCTCTCTCTCACTCTGC[A/T]GGCAGGAGAAGGAGGCATCAGAACGCTGCTGTGGTGAGGACATGGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114911 Nonsense 533 701 14 18
ENSDART00000131320   None 86 None 4
ENSDART00000134398 Nonsense 455 524 14 15
ENSDART00000134888   None 101 None 6
ENSDART00000137816   None 197 None 8
ENSDART00000148100   None 186 None 7
Genomic Location (Zv9):
Chromosome 13 (position 10685039)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10987368
KASP Assay ID:
2260-6119.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCTCTCTCTCACTCTGCAGGCAGGAGAAGGAGGCATCAGARCGCTG[C/A]TGTGGYGAGGACATGGCCGCTCTGACCTTCCAGGCACAGCGGCGCGAAMG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114911 Essential Splice Site 603 701 None 18
ENSDART00000131320   None 86 None 4
ENSDART00000134398   525 524 None 15
ENSDART00000134888   None 101 None 6
ENSDART00000137816   None 197 None 8
ENSDART00000148100   None 186 None 7
Genomic Location (Zv9):
Chromosome 13 (position 10689005)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10991334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCACACACTCGGGGCAAAGCTGGAGGAACTGGCTCAGAGCAGCAGG[T/C]ATGTTGCACTTTCATTTAAGMTCACGTATACCAYTAWAACAAGGTTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link