ENOX2

Ensembl ID:
ENSDARG00000078942
Description:
ecto-NOX disulfide-thiol exchanger 2 [Source:HGNC Symbol;Acc:2259]
Human Orthologue:
ENOX2
Human Description:
ecto-NOX disulfide-thiol exchanger 2 [Source:HGNC Symbol;Acc:2259]
Mouse Orthologue:
Enox2
Mouse Description:
ecto-NOX disulfide-thiol exchanger 2 Gene [Source:MGI Symbol;Acc:MGI:2384799]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22470 Nonsense Mutation detected in F1 DNA During 2014
sa16714 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084664 Nonsense 494 680 10 15
Genomic Location:
Chromosome 14 (position 24447357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTAAAGCGCAGCCCCAGCGCAGCGAGGAGGATGCCACCCGCCAGCAG[C/T]AGCTCAGCTTCCTGCAGCAGGCTCTGCAGGGCATGCAGAAGGTATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084664 Essential Splice Site 638 680 15 15
Genomic Location:
Chromosome 14 (position 24481764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATATGAAAGGAGTTGRAGTGTTTTAATCATCATTTTTCTTGTTGTTTC[A/T]GATCAGTACCACAGAAGTGGAGAGTCTTTTGGGTCGYCTGCCCTGCACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ujbjad2s