NP_001093534.1

Ensembl ID:
ENSDARG00000078938
Description:
hypothetical protein LOC799523 [Source:RefSeq peptide;Acc:NP_001093534]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38452 Nonsense Mutation detected in F1 DNA During 2017
sa20349 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109052 Nonsense 131 537 2 8
Genomic Location (Zv9):
Chromosome 5 (position 10914911)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9502671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGAGGCACCAGAAACATCACCAGGAGCTTCTGTGCCTGAGAACGGG[G/T]AACCCACCACATCCCCAGTCCTCAAGAGCCAGATAGAGTCGCCTGGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109052 Nonsense 322 537 5 8
Genomic Location (Zv9):
Chromosome 5 (position 10913269)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 9501029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGGGGACAAAATCAGATTCCTGTACCACAGCCTGAGGAGCAACCTGAA[A/T]GACCTCAGCAGAGAGATTTAATAATAAATGGAAGAGTCCGTGGGGTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link