bat5l

Ensembl ID:
ENSDARG00000078929
ZFIN ID:
ZDB-GENE-060307-3
Description:
protein BAT5 [Source:RefSeq peptide;Acc:NP_001104648]
Human Orthologues:
BAT5, C20orf135
Human Descriptions:
chromosome 20 open reading frame 135 [Source:HGNC Symbol;Acc:16128]
HLA-B associated transcript 5 [Source:HGNC Symbol;Acc:13921]
Mouse Orthologues:
Bat5, BC050777
Mouse Descriptions:
cDNA sequence BC050777 Gene [Source:MGI Symbol;Acc:MGI:3607711]
HLA-B associated transcript 5 Gene [Source:MGI Symbol;Acc:MGI:99476]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15277 Nonsense Available for shipment Available now
sa6412 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110606 Nonsense 102 543 4 20
ENSDART00000125621 Nonsense 115 557 5 22
Genomic Location (Zv9):
Chromosome 16 (position 12115786)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10615452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTCAGTATGTWGGAACAGCGCTGGTCTGTCTGCTYGGAGTGGCCTG[T/A]CTGAGAGGTGATGCTATATTTACNTTTTTTTATTACCAATGTTTGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110606 Nonsense 330 543 12 20
ENSDART00000125621 Nonsense 343 557 13 22
Genomic Location (Zv9):
Chromosome 16 (position 12098796)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10598462
KASP Assay ID:
554-4179.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAYGCGATGGACGTGGTCATTCAGTTTGCTGTGCACAAACTGGGCTTC[C/T]AGTTGAGTGACATCATAGTTTATGCCTGGTCGATAGGGGGATTCACAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link