bat5l

Ensembl ID:
ENSDARG00000078929
ZFIN ID:
ZDB-GENE-060307-3
Description:
protein BAT5 [Source:RefSeq peptide;Acc:NP_001104648]
Human Orthologues:
BAT5, C20orf135
Human Descriptions:
chromosome 20 open reading frame 135 [Source:HGNC Symbol;Acc:16128]
HLA-B associated transcript 5 [Source:HGNC Symbol;Acc:13921]
Mouse Orthologues:
Bat5, BC050777
Mouse Descriptions:
cDNA sequence BC050777 Gene [Source:MGI Symbol;Acc:MGI:3607711]
HLA-B associated transcript 5 Gene [Source:MGI Symbol;Acc:MGI:99476]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15277 Nonsense Available for shipment Available now
sa3972 Nonsense Mutation detected in F1 DNA During 2014
sa6412 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110606 Nonsense 102 543 4 20
ENSDART00000125621 Nonsense 115 557 5 22
Genomic Location:
Chromosome 16 (position 12115786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTCAGTATGTWGGAACAGCGCTGGTCTGTCTGCTYGGAGTGGCCTG[T/A]CTGAGAGGTGATGCTATATTTACNTTTTTTTATTACCAATGTTTGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110606 Nonsense 247 543 9 20
ENSDART00000125621 Nonsense 260 557 10 22
Genomic Location:
Chromosome 16 (position 12107694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTCAGTATGAAGGTCAGCGGAACAAACTGGTGGCTTGTGATGGGAAT[G/T]AGATCGACACCATGTTTGTGGACCGGAGGAGAGATGGAGGAACAGCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110606 Nonsense 330 543 12 20
ENSDART00000125621 Nonsense 343 557 13 22
Genomic Location:
Chromosome 16 (position 12098796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAYGCGATGGACGTGGTCATTCAGTTTGCTGTGCACAAACTGGGCTTC[C/T]AGTTGAGTGACATCATAGTTTATGCCTGGTCGATAGGGGGATTCACAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2xnlhenj