comtd1

Ensembl ID:
ENSDARG00000078918
ZFIN ID:
ZDB-GENE-030131-1072
Description:
catechol-O-methyltransferase domain containing 1 [Source:RefSeq peptide;Acc:NP_001157280]
Human Orthologue:
COMTD1
Human Description:
catechol-O-methyltransferase domain containing 1 [Source:HGNC Symbol;Acc:26309]
Mouse Orthologue:
Comtd1
Mouse Description:
catechol-O-methyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916406]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8488 Nonsense Mutation detected in F1 DNA During 2014
sa1067 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa8488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108921 Nonsense 94 238 4 7
ENSDART00000137776 None None 119 None 3
ENSDART00000148269 Nonsense 142 286 4 7
Genomic Location:
Chromosome 13 (position 17729464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGCTCATTTTGTACCTCTCTTAGGTCTGTACACTGGATACAACGCCT[T/A]RAGTCTGGCTCTGGTAGTTCCTGAGAATGGACGTGTGGTGGCCTGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1067
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108921 Nonsense 120 238 4 7
ENSDART00000137776 None None 119 None 3
ENSDART00000148269 Nonsense 168 286 4 7
Genomic Location:
Chromosome 13 (position 17729541)
KASP Assay ID:
554-0970.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGACGTGTGGTGGCCTGTGAAATTAATGAGGATTATGTGAAAATAGGC[A/T]AGCCATTTTTTGCMGAGGTAAAGCAAAACGTACAAAGWTTRTAAAGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tax2jjlc