chrdl2

Ensembl ID:
ENSDARG00000078916
ZFIN ID:
ZDB-GENE-081104-305
Description:
chordin-like protein 2 [Source:RefSeq peptide;Acc:NP_001124431]
Human Orthologue:
CHRDL2
Human Description:
chordin-like 2 [Source:HGNC Symbol;Acc:24168]
Mouse Orthologue:
Chrdl2
Mouse Description:
chordin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1916371]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25157 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113734 Nonsense 446 454 11 11
Genomic Location:
Chromosome 21 (position 20724402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGAGCTGTGAAGACGGGATCAAGGAAGTGGTGAAGTACTTAAACCCT[G/T]AACAGCTGGACAGTCTTTGCACATCTTAGTCTCCTCTCCGCTTAAACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t20kbl8n