brd4

Ensembl ID:
ENSDARG00000078904
ZFIN IDs:
ZDB-GENE-030131-267, ZDB-GENE-030131-267
Description:
bromodomain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001104751]
Human Orthologue:
BRD4
Human Description:
bromodomain containing 4 [Source:HGNC Symbol;Acc:13575]
Mouse Orthologue:
Brd4
Mouse Description:
bromodomain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1888520]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8905 Nonsense Mutation detected in F1 DNA During 2017
sa855 Nonsense F2 line generated During 2017
sa33315 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114343 Nonsense 201 1444 4 21
ENSDART00000115117 Nonsense 201 1444 6 20
Genomic Location (Zv9):
Chromosome 3 (position 53836543)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52943858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTGCAAGCCCTCAAACACGTGGCCTTTCTAATCTTACCCCAGGGCCA[C/T]AAACTAGAGGACCACCACAGGGTCCACCTACTTTACCTCCCCAGCCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa855
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114343 Nonsense 880 1444 11 21
ENSDART00000115117 Nonsense 880 1444 13 20
Genomic Location (Zv9):
Chromosome 3 (position 53844558)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52951873
KASP Assay ID:
554-0758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCCACCTCACCTCAACGCTCACCCTCCAGGAGGCCCAGTGTCACCT[G/T]AGACGCATCCGTTCCTCAACCAGCACCCCATCCTTCCATCCCCAGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114343 Nonsense 1072 1444 12 21
ENSDART00000115117 Nonsense 1072 1444 14 20
Genomic Location (Zv9):
Chromosome 3 (position 53849562)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52956877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGACTCAAGTGCAGCCGCAGCAGCCAGCGCCACACCAGCCCTCGCCA[C/T]AGCTCTCACAGCACCAGGCCAGACACATGCAGCAGCTCGGCTTCCCTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link