ANKS1A (2 of 2)

Ensembl ID:
ENSDARG00000078901
Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Human Orthologue:
ANKS1A
Human Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Mouse Orthologue:
Anks1
Mouse Description:
ankyrin repeat and SAM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45267 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110433 Essential Splice Site 120 483 4 12
Genomic Location (Zv9):
Chromosome 6 (position 54353156)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54389890
GRCz11 6 54397998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGGGAGTAGATGCATAACGTGTACACTGACCATCATTTCTATGTGCA[G/T]GTGTTAAAAATTGGCCTTCTTGGTCACAGAAAAAGGATCATAGCCTCGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link