ANKS1A (2 of 2)

Ensembl ID:
ENSDARG00000078901
Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Human Orthologue:
ANKS1A
Human Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Mouse Orthologue:
Anks1
Mouse Description:
ankyrin repeat and SAM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446180]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18856 Nonsense Mutation detected in F1 DNA During 2014
sa3587 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110433 Nonsense 58 483 2 12
ENSDART00000110433 Nonsense 58 483 2 12
Genomic Location:
Chromosome 6 (position 54352580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAAGACGAGGACCTTCACGAAATTGGCATCACCGATCCAGGCCAC[A/T]GAAAGAAAATCCTTCATGCAGCAAAAAGCCTTCCAAAGGTACCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110433 Nonsense 58 483 2 12
ENSDART00000110433 Nonsense 58 483 2 12
Genomic Location:
Chromosome 6 (position 54352580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGAAGACGAGGACCTTCAYGAAATTGGCATCACCGATCCAGGCCAC[A/T]GAAAGAAAATCCTTCATGCAGCAAAAAGCCTTCCAAAGGTACCAWGTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qqif4lxi