prp

Ensembl ID:
ENSDARG00000078899
ZFIN ID:
ZDB-GENE-090826-1
Human Orthologue:
COL22A1
Human Description:
collagen, type XXII, alpha 1 [Source:HGNC Symbol;Acc:22989]
Mouse Orthologue:
Col22a1
Mouse Description:
collagen, type XXII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1916950]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30459 Nonsense Mutation detected in F1 DNA During 2017
sa30458 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19381 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30457 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38193 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24791 Nonsense Available for shipment Available now
sa44408 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Nonsense 497 1634 9 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 94368)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 94368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCTACAGGGTGATACAGGTCTACCGGGTGCCCCGGGGCCCAAGGGT[G/T]AAAAGGTCAATTAGCATTTTACAATCACAACATCCTCAATATGCATCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 586 1634 14 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 82139)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 82139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAGGAGTTGCTGGTGAAGCTGGGCTGCCTGGACCACTCGGACCAAAG[G/A]TTAGACATTAACACTTACAGACAGAGTTACAGTGTTTCTTGATGAGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 641 1634 17 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 76978)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 76978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGAGGGCTGATTGGTGCTCCTGGTCCAAATGGAGTAAAAGGAGAAAAG[G/T]TAGAGTTGTGCAATTTATTATCTAATTTTATTATTTTATTTCATATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 682 1634 21 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 72887)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 72887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTGTTTTTAATCAGCCTATTGTTGATGCTGTTTTTTTTTTCTTCCAC[A/T]GGGTCCTCCTGGACCTCCAGGTTTGCCTGGTGAGACGGGTGACACTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 887 1634 33 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 52505)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 52505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAACTGTTAACATTAATATAATAATATCACAATATCTTTGATATTTCC[A/T]GGGTCAAAGAGGACTACCTGGAGAGCAAGGTTTCAGAGGACAACCAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Nonsense 1393 1634 63 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 33755)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 33755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATTTGAACTAAACTTGTGTTTATCACAGGGCATGTTAGGAAAAGCT[G/T]GAGACCGAGGACAGAAGGGAGAAAAGGTTTGCATGCATAGGTCCACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 1401 1634 63 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 33728)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 33728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGGCATGTTAGGAAAAGCTGGAGACCGAGGACAGAAGGGAGAAAAG[G/A]TTTGCATGCATAGGTCCACCTAATCATCTATCAGTCCATAATTTAACCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link