ENSDARG00000078898

Ensembl ID:
ENSDARG00000078898
Human Orthologue:
PCDH7
Human Description:
protocadherin 7 [Source:HGNC Symbol;Acc:8659]
Mouse Orthologue:
Pcdh7
Mouse Description:
protocadherin 7 Gene [Source:MGI Symbol;Acc:MGI:1860487]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19453 Nonsense Mutation detected in F1 DNA During 2014
sa18574 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111475 Nonsense 940 1283 2 6
Genomic Location:
Chromosome 1 (position 13868925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGAAGGAGCCAGAAGAGGACTTTTTCGGTCCACAGCCTCCCCCTCTA[C/T]AAGCCCAGGGCTCCCAAAATGAGCGTGGGCGCAAACCACGCAGAGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111475 Essential Splice Site 1154 1283 5 6
Genomic Location:
Chromosome 1 (position 13926963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAGTTCTTGACAGGATCTCCTAAAAAGGCCTCTGTTCTCTTTTCCTC[A/T]GACTCCAGGCAGCTYCCTGACGTGGCTCTGACAGGAAAATGCACACACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lipid traits: A genome-wide screen for interactions reveals a new locus on 4p15 modifying the effect of waist-to-hip ratio on total cholesterol. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cdis65vs