LOC100003958

Ensembl ID:
ENSDARG00000078891
Human Orthologue:
C7orf43
Human Description:
chromosome 7 open reading frame 43 [Source:HGNC Symbol;Acc:25604]
Mouse Orthologues:
BC037034, RP24-86H20.1
Mouse Descriptions:
cDNA sequence BC037034 (BC037034), mRNA [Source:RefSeq DNA;Acc:NM_153161]
cDNA sequence BC037034 Gene [Source:MGI Symbol;Acc:MGI:2385896]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20944 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109268 Nonsense 456 595 8 10
Genomic Location:
Chromosome 7 (position 27499310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGTGAATGCAGTGGTGTGTCATTCACCTCTTAGTAATCTGGGATA[C/A]TGTCGAAAAGGCAGCACTCTCTCCGTCAGTGTGGCCTTCCAGATTCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/couv2b13