si:ch211-259k10.1

Ensembl ID:
ENSDARG00000078890
ZFIN ID:
ZDB-GENE-070705-153
Description:
Novel protein similar to vertebrate WD repeat and FYVE domain containing 3 (WDFY3) [Source:UniProtKB
Mouse Orthologue:
Wdfy3
Mouse Description:
WD repeat and FYVE domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1096875]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33670 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17802 Essential Splice Site, Missense Available for shipment Available now
sa20498 Nonsense Available for shipment Available now
sa9941 Essential Splice Site Available for shipment Available now
sa33669 Nonsense Available for shipment Available now
sa2247 Nonsense F2 line generated During 2017
sa20497 Nonsense Available for shipment Available now
sa10584 Nonsense Available for shipment Available now
sa2246 Essential Splice Site F2 line generated During 2017
sa14824 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6996 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 339 3522 7 65
ENSDART00000146664 Essential Splice Site 319 375 6 7
Genomic Location (Zv9):
Chromosome 5 (position 41781605)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39556322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTCCGCATGTGTCAGGGCTACACCTTCCTCATAGATCTTATGATCAG[G/T]TGACTTATTTGTAATTGTTTATTGCATGTTTAAATGTTTAGTGTTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 394 3522 8 65
ENSDART00000146664 Missense 375 375 7 7
Genomic Location (Zv9):
Chromosome 5 (position 41780305)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39555022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACCCTTCCTGCTTCCAGGTTTTGTGGTTCCACAGCCTTCTGGGAAAG[G/A]TCAGCCCTCTATAAAATAGCATACACTGGAGTCTTGACTTGTGTCATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 585 3522 11 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41770387)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39545104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGACATGGAGATGAGTTAATAATACAGATATGTCAATCTCTCAGGGT[T/A]GTTCCGGGAGTTTGGGGGAGCGCGGTGTGTGCACAACATTGTGAAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 829 3522 13 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41767565)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39542282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACCTCGCTGCCCTCCCCTTGGGGCACGCCAGCAATCACCAGGAAGAG[G/A]TACTGCTTTCTGCCACCTCTTCCTTTTTCTCCCTCTGTCTTTTCCTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 1397 3522 23 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41733778)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39508495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCACACCAGTCAAGCTTGTTCATAATGCAGTAGGCCATCTCAACGGAT[C/A]AGCCAGGACCGTTGGAGCTGCAGTCATTGGTTACCTGGGTGAGTGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2247
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2452 3522 43 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41706026)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39480743
KASP Assay ID:
554-3279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAATGTACCAGCACTCCATAGAGCAGAACACAGAGGGAGAAACCACA[C/T]AACAAGAACCCGAACATGGAGAGGACACCATCGCAAGGGTCAAAGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2504 3522 44 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41703741)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39478458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGACCAGCTGCAGGAGCTGCTGGAGTCAGGAGCAATGGATGAAGAG[C/T]AGAAAACAGACAACACCACACTGCTCCGTCTGCTGGAGGAGGGAGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2769 3522 52 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41697530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39472247
KASP Assay ID:
2259-6288.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACTTTTAAAACAAGGTTTTRTTTCTGTACAGGCGAGACTCCGGCATA[T/G]CATTACGGCACTCATTACTCTTCTGCAATGATTGTTGCCTCATATCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2246
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 2952 3522 55 65
ENSDART00000146664   None 375 None 7
ENSDART00000114481 Essential Splice Site 2952 3522 55 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41694785)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39469502
KASP Assay ID:
554-3250.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGCCACAATTGGATTCATTAACAACTTTGGYCAGATCCCGAAACAGG[T/C]TTGYGATTTCATTTTCCAAAATCTYATAAACATTTTCCAGTGAATWGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 3417 3522 63 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41679720)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39454437
KASP Assay ID:
554-5050.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGGACAACGCTCATCCTGCCGAAATCACCGCTCTTGCCATTTCAAAG[T/C]AGGCGCTTTGTGTGTTCTGTGGGGAAATGAGAATAAAAGAGAAGAWGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 3417 3522 63 65
ENSDART00000146664   None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41679720)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39454437
KASP Assay ID:
554-5050.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGGACAACGCTCATCCTGCCGAAATCACCGCTCTTGCCATTTCAAAG[T/C]AGGCGCTTTGTGTGTTCTGTGGGGAAATGAGAATAAAAGAGAAGAWGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link