LOC100332271

Ensembl ID:
ENSDARG00000078888
Human Orthologue:
IQGAP1
Human Description:
IQ motif containing GTPase activating protein 1 [Source:HGNC Symbol;Acc:6110]
Mouse Orthologue:
Iqgap1
Mouse Description:
IQ motif containing GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1352757]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7084 Nonsense Mutation detected in F1 DNA During 2014
sa11898 Essential Splice Site Available for shipment Available now
sa15628 Essential Splice Site Available for shipment Available now
sa9487 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Nonsense 186 1655 7 37
Genomic Location:
Chromosome 7 (position 52159909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTCTGTCYTTTATCTTTTCAGAGGAGGAGATCAACAAMATGAAGATC[G/T]AATTAGAGAAATACAACATTCAAATGCCAGCCTTCAGCAAAATCGGTGGR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 274 1655 8 37
Genomic Location:
Chromosome 7 (position 52159457)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCTGTTCCAGGCCAAGAGTGAGAAAGTGGCCAACTCCCGAAAGAGAG[T/C]ACGAACTGCACTSTACWATTAAGAGATTTGTTGTACTTGAGTTACTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 677 1655 17 37
Genomic Location:
Chromosome 7 (position 52134199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTACCAGGATGACCTGCTGCGRATTAAAGACGACAAGAGAAAGGAAG[G/A]TGAGATGGGCTCTTCTGTTGATTYTTTAATATYTGGTACWAAACAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 1485 1655 33 37
Genomic Location:
Chromosome 7 (position 52108587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACACCCTGAGAAGAAATACCAGGACCTAATCAATGACATCGCCAAGG[T/C]ACTGTWCTTGGATGTGTCCTAGCATTTACATTCTGCATGTCAAGGGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/moec9zuy