LOC100332271

Ensembl ID:
ENSDARG00000078888
Human Orthologue:
IQGAP1
Human Description:
IQ motif containing GTPase activating protein 1 [Source:HGNC Symbol;Acc:6110]
Mouse Orthologue:
Iqgap1
Mouse Description:
IQ motif containing GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1352757]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41010 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7084 Nonsense Mutation detected in F1 DNA During 2016
sa11898 Essential Splice Site Available for shipment Available now
sa15628 Essential Splice Site Available for shipment Available now
sa41009 Nonsense Mutation detected in F1 DNA During 2016
sa34178 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9487 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 154 1655 5 37
Genomic Location (Zv9):
Chromosome 7 (position 52165618)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50435458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAGGAAGAACATGCCACGCTGTATCTATTGCATACATGCTCTCAGG[T/A]AATCTAATATGTCACTGTGGGCTCATTCAGAAAACTCGTGTTAGGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Nonsense 186 1655 7 37
Genomic Location (Zv9):
Chromosome 7 (position 52159909)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50429749
KASP Assay ID:
554-4428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTCTGTCYTTTATCTTTTCAGAGGAGGAGATCAACAAMATGAAGATC[G/T]AATTAGAGAAATACAACATTCAAATGCCAGCCTTCAGCAAAATCGGTGGR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 274 1655 8 37
Genomic Location (Zv9):
Chromosome 7 (position 52159457)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50429297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCTGTTCCAGGCCAAGAGTGAGAAAGTGGCCAACTCCCGAAAGAGAG[T/C]ACGAACTGCACTSTACWATTAAGAGATTTGTTGTACTTGAGTTACTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 677 1655 17 37
Genomic Location (Zv9):
Chromosome 7 (position 52134199)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50404039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTACCAGGATGACCTGCTGCGRATTAAAGACGACAAGAGAAAGGAAG[G/A]TGAGATGGGCTCTTCTGTTGATTYTTTAATATYTGGTACWAAACAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Nonsense 1253 1655 28 37
Genomic Location (Zv9):
Chromosome 7 (position 52111383)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50381223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAGATGTTCCTTGGAGACAACGCACATTTGAACCCCATCAACGAATA[C/A]CTCGCCAACTCCTACCAGAAATTTAGGTAAAAGTGATATCAGTGCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 1416 1655 33 37
Genomic Location (Zv9):
Chromosome 7 (position 52108799)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50378639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAGCTTTATCAAACTTTGTAATAAAGTCAGCACTTTTATTTGAAACA[G/A]GAAGCAGAGTACCAGCGAGCTATGCAGCGGCGAGCCATTCGCGATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110283 Essential Splice Site 1485 1655 33 37
Genomic Location (Zv9):
Chromosome 7 (position 52108587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50378427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACACCCTGAGAAGAAATACCAGGACCTAATCAATGACATCGCCAAGG[T/C]ACTGTWCTTGGATGTGTCCTAGCATTTACATTCTGCATGTCAAGGGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link