si:dkey-20i10.6

Ensembl ID:
ENSDARG00000078887
ZFIN ID:
ZDB-GENE-090313-231
Description:
probable phospholipid-transporting ATPase VD [Source:RefSeq peptide;Acc:NP_001139079]
Human Orthologue:
ATP10D
Human Description:
ATPase, class V, type 10D [Source:HGNC Symbol;Acc:13549]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42153 Nonsense Mutation detected in F1 DNA During 2017
sa22247 Nonsense Available for shipment Available now
sa35435 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6288 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Nonsense 81 1365 1 22
ENSDART00000108543   None 1361 None 21
ENSDART00000143557   None 1228 None 21
Genomic Location (Zv9):
Chromosome 13 (position 12265207)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12263575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGCTTTTCCAAAGGCTTCCAGAACAACAGCATCCGGACCACCAAATA[C/A]ACCCTCATCAGTTTCATCCCCATGAATCTGTTCCAGCAGTTTCACAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525   None 1365 None 22
ENSDART00000108543 Nonsense 31 1361 1 21
ENSDART00000143557   None 1228 None 21
Genomic Location (Zv9):
Chromosome 13 (position 12274452)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12272820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAAGACAGTGTCTTTGGAGCGGAAAAGTCCAGCTGCCATGATTCAAT[C/A]AGTGGACGGAGATCAAGGAGGTACAGCTAAAGATCTGACCAAAAGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Essential Splice Site 803 1365 11 22
ENSDART00000108543 Essential Splice Site 799 1361 10 21
ENSDART00000143557 Essential Splice Site 666 1228 10 21
Genomic Location (Zv9):
Chromosome 13 (position 12298471)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12296839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTATACAAAAGGAGCAGATAATGTCATTATGGAGCTAGCTAAACAAG[G/A]TAAGTGAGGTTATGTTCTTGCTTTACTAAAATCATTTTTCACAGGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Nonsense 1076 1365 17 22
ENSDART00000108543 Nonsense 1072 1361 16 21
ENSDART00000143557 Nonsense 939 1228 16 21
Genomic Location (Zv9):
Chromosome 13 (position 12312836)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12311204
KASP Assay ID:
554-4613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGTGACTTTGCCATCTCTCGATTYAAGTTCCTGAGAAAGCTGATTT[T/A]GGTTCATGGTCATTGGTGCTACGCCCRTTTGGCTAACATGATCCTCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link