ENSDARG00000078880

Ensembl ID:
ENSDARG00000078880

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39314 Nonsense Mutation detected in F1 DNA During 2016
sa23838 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129473 Nonsense 171 252 2 2
Genomic Location (Zv9):
Chromosome 21 (position 2709057)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2163678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACGTGAAGCCGTTGAGCTGTGATCAGTGCCATAAAACATTTCTCTCC[A/T]GATCACGGTTAAAATCACACCTTAAATTTCACTCTGAAGTGAAGCCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129473 Nonsense 174 252 2 2
Genomic Location (Zv9):
Chromosome 21 (position 2709067)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2163668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTTGAGCTGTGATCAGTGCCATAAAACATTTCTCTCCAGATCACGGT[T/A]AAAATCACACCTTAAATTTCACTCTGAAGTGAAGCCTCACGTTTGCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link