si:dkey-21n8.1

Ensembl ID:
ENSDARG00000078866
ZFIN ID:
ZDB-GENE-081104-374
Human Orthologue:
SDK1
Human Description:
sidekick homolog 1, cell adhesion molecule (chicken) [Source:HGNC Symbol;Acc:19307]
Mouse Orthologue:
Sdk1
Mouse Description:
sidekick homolog 1 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2444413]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20103 Nonsense Available for shipment Available now
sa33280 Nonsense Mutation detected in F1 DNA During 2017
sa33279 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33278 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40137 Essential Splice Site Mutation detected in F1 DNA During 2017
sa476 Nonsense Confirmed mutation in F2 line During 2017
sa33277 Nonsense Mutation detected in F1 DNA During 2017
sa11116 Nonsense Available for shipment Available now
sa20102 Essential Splice Site Available for shipment Available now
sa10466 Nonsense Available for shipment Available now
sa10734 Essential Splice Site Available for shipment Available now
sa1775 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Nonsense 31 2090 2 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41281992)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41145352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGGATGTGAATTGAAGTTGTTGTTTCTCTTTTTATACTCTTAGGTA[C/A]ACCATTTCCTCTCTCCAGCGCTCCAATATGGGTGTTTATCAGTGTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Nonsense 149 2090 4 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41213851)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 41077211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCGGGAGGTACTACGTCCAGGCCGTTAATGAGAAGAATGGAGAAAAC[A/T]AGACAAGCCCATCTATTTACCTGAATGTGGCAGGTAAGTTGCATGCGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Essential Splice Site 541 2090 12 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41130993)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40994353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTCTGAGGCCGGCAACGAATCCAAGGAGGCTCGTCTGGAGGTCATG[T/A]AAGTGACTTGGCTTGCCTTCATAGCGAGCATTAGGCTGACTAATGCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Essential Splice Site 587 2090 13 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41122157)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40985517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAAACAGCCCACTGCTGCATTATGTGGTTGAGCTCTCAGAGAACAG[T/C]AAGATATATACACACACACAGATACTCACACACTCCTTCATGCGTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Essential Splice Site 636 2090 14 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41111199)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40974559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGTCAATCAGGTGGGCAGGGGCCAGTACAGCACCGAAACCAACAGG[T/C]AGGAGGCCACATTTGTCAACAGCTGCTTATTCACATGTTGTCCACCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa476
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Nonsense 705 2090 16 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41097870)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40961230
KASP Assay ID:
554-0208.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCTGGAGAGTACCAGCAGAAGAACATCAGCAGCCCTGAGATCAACTA[C/A]TGCCTGATCACAGAGCTCATCATCTGGACCCAGTATGAGATTCAGGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Nonsense 772 2090 17 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41087113)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40950473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGTGAACTCAACCACCATTGAATTTTCCTGGAATCCACCGCCTCAA[C/T]AGTTCATCAATGGCATTAATCAAGGTTACAAGGTAAACCCCTTTCTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Nonsense 834 2090 18 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41086840)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40950200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCAGCTGGTACTTGACGTCAGTGCTGTGCTTCACCACACCAGGGAAC[G/T]GACCCCGCAGTSCCCCCAAAYTAGTGCAGACTTTCGAGGACAGTAAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Essential Splice Site 847 2090 18 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41086797)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40950157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAACGGACCCCGCAGTCCCCCCAAACTAGTGCAGACTTTCGAGGACA[G/A]TAAGTTAAAGTCATAAGGTTGGGTTTCTTTCTCTGACTGAATTTTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Nonsense 957 2090 21 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41079208)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40942568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTTCAATGCAGAGCTTCCCGGGCCTCCCTCSAATCYGGTTATTTCC[A/T]AGATCAGTTCACGATCTGCTACGCTCAAGTTCCGCGCAGGGGATGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Essential Splice Site 1022 2090 22 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41072188)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40935548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCAGATGCTGGAGGTTCCCAATCTCACCCCCTTCACACACTACAGG[T/G]CAGTCAGACCCCTCCACAGGCATACATTAACTGCTTTTAACGCAGCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111856 Essential Splice Site 1522 2090 32 44
ENSDART00000144088   None 518 None 10
Genomic Location (Zv9):
Chromosome 3 (position 41018098)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40881458
KASP Assay ID:
554-1768.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCAAAGCGGCCCGTCAACAGCTCCCAGCTGCGYACCGAACTGACAGG[T/C]AACTAGCGGGAGGAGGCTCTCCTCTTGAACCAGAAACGTCTGCACGCAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link